ID: 934623220_934623226

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 934623220 934623226
Species Human (GRCh38) Human (GRCh38)
Location 2:95829070-95829092 2:95829106-95829128
Sequence CCTGGAGGCTCTGTCCAGGGAGT CTGGCTCGACAGCTCTGGCAGGG
Strand - +
Off-target summary {0: 23, 1: 44, 2: 53, 3: 68, 4: 328} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!