ID: 934638142_934638150

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 934638142 934638150
Species Human (GRCh38) Human (GRCh38)
Location 2:96009728-96009750 2:96009763-96009785
Sequence CCCAGATACCTTTCCTTAGACAG AAACTTCTCAAATAGAAGTCGGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 0, 3: 19, 4: 288}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!