ID: 934638143_934638152

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 934638143 934638152
Species Human (GRCh38) Human (GRCh38)
Location 2:96009729-96009751 2:96009782-96009804
Sequence CCAGATACCTTTCCTTAGACAGG CGGGCCATGGCACGCCACTGAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 1, 3: 8, 4: 159}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!