ID: 934838109_934838112

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 934838109 934838112
Species Human (GRCh38) Human (GRCh38)
Location 2:97607855-97607877 2:97607876-97607898
Sequence CCTGCCTGGCAGAAAGTGGGGGA GAAGAGAACTGCCTCCATGAGGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 3, 3: 53, 4: 1211} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!