ID: 934839445_934839451

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 934839445 934839451
Species Human (GRCh38) Human (GRCh38)
Location 2:97616037-97616059 2:97616062-97616084
Sequence CCAGCCCTTACAGACAGCAGGCC GCCTCCAAGACACTACCCCATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!