ID: 934843626_934843632

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 934843626 934843632
Species Human (GRCh38) Human (GRCh38)
Location 2:97647060-97647082 2:97647083-97647105
Sequence CCTTTAGGTGGTGTTCCCACTGA TGAAGAGCAGGCGACTGGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 69} {0: 1, 1: 0, 2: 0, 3: 11, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!