ID: 934843629_934843636

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 934843629 934843636
Species Human (GRCh38) Human (GRCh38)
Location 2:97647076-97647098 2:97647113-97647135
Sequence CCACTGATGAAGAGCAGGCGACT GATCATGCTGGCTGCAAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 95} {0: 1, 1: 1, 2: 17, 3: 115, 4: 795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!