ID: 934846377_934846391

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 934846377 934846391
Species Human (GRCh38) Human (GRCh38)
Location 2:97663733-97663755 2:97663783-97663805
Sequence CCACGCAGTGAGCGGAGGACGCG GCCGCCGCGTGCGCCCCCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 105} {0: 1, 1: 0, 2: 4, 3: 15, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!