ID: 935325757_935325771

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 935325757 935325771
Species Human (GRCh38) Human (GRCh38)
Location 2:101935544-101935566 2:101935583-101935605
Sequence CCTCACCTGGGAAGTGCAAGGGG CCTAGCCAAGGGAGGGTGTGAGG
Strand - +
Off-target summary {0: 334, 1: 1454, 2: 2136, 3: 2167, 4: 1817} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!