ID: 935325759_935325771

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 935325759 935325771
Species Human (GRCh38) Human (GRCh38)
Location 2:101935549-101935571 2:101935583-101935605
Sequence CCTGGGAAGTGCAAGGGGTCAGG CCTAGCCAAGGGAGGGTGTGAGG
Strand - +
Off-target summary {0: 443, 1: 1439, 2: 1310, 3: 1167, 4: 1152} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!