ID: 935365469_935365473

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 935365469 935365473
Species Human (GRCh38) Human (GRCh38)
Location 2:102285100-102285122 2:102285120-102285142
Sequence CCATCCCCATCTTGCAGCACATA ATACTGTTTTCCAGCCACACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 45, 4: 331}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!