ID: 935365470_935365473 |
View in Genome Browser |
Spacer: -7 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 935365470 | 935365473 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 2:102285104-102285126 | 2:102285120-102285142 |
| Sequence | CCCCATCTTGCAGCACATACTGT | ATACTGTTTTCCAGCCACACTGG |
| Strand | - | + |
| Off-target summary | No data | {0: 1, 1: 0, 2: 7, 3: 45, 4: 331} |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||