ID: 935627309_935627316

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 935627309 935627316
Species Human (GRCh38) Human (GRCh38)
Location 2:105181726-105181748 2:105181778-105181800
Sequence CCAATAACCCTGGCTCTGACATG TTTCCTTATCTGTGAAATGGAGG
Strand - +
Off-target summary No data {0: 8, 1: 87, 2: 386, 3: 1439, 4: 3345}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!