|
Left Crispr |
Right Crispr |
Crispr ID |
935656726 |
935656730 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:105429572-105429594
|
2:105429598-105429620
|
Sequence |
CCTTCTCTAGAGCCTCCAGAATG |
CCCTGCTGATACCTTGATTCTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 3, 2: 12, 3: 83, 4: 363} |
{0: 1, 1: 15, 2: 160, 3: 624, 4: 1540} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|