ID: 935656726_935656730

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 935656726 935656730
Species Human (GRCh38) Human (GRCh38)
Location 2:105429572-105429594 2:105429598-105429620
Sequence CCTTCTCTAGAGCCTCCAGAATG CCCTGCTGATACCTTGATTCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 12, 3: 83, 4: 363} {0: 1, 1: 15, 2: 160, 3: 624, 4: 1540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!