ID: 935691753_935691757

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 935691753 935691757
Species Human (GRCh38) Human (GRCh38)
Location 2:105738177-105738199 2:105738221-105738243
Sequence CCTGCTAGAAGTCTTCCCTTTTA ATGACTAGGCTGTAAGTAACTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!