ID: 935724481_935724487

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 935724481 935724487
Species Human (GRCh38) Human (GRCh38)
Location 2:106011089-106011111 2:106011124-106011146
Sequence CCCAATAAATCCCATTTTTCTCA TCCACGAGCCTAATTTTTCATGG
Strand - +
Off-target summary {0: 10, 1: 61, 2: 63, 3: 125, 4: 526} {0: 1, 1: 0, 2: 18, 3: 139, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!