ID: 935724481_935724490

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 935724481 935724490
Species Human (GRCh38) Human (GRCh38)
Location 2:106011089-106011111 2:106011137-106011159
Sequence CCCAATAAATCCCATTTTTCTCA TTTTTCATGGTCATGTGACAAGG
Strand - +
Off-target summary {0: 10, 1: 61, 2: 63, 3: 125, 4: 526} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!