ID: 935724482_935724487

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 935724482 935724487
Species Human (GRCh38) Human (GRCh38)
Location 2:106011090-106011112 2:106011124-106011146
Sequence CCAATAAATCCCATTTTTCTCAC TCCACGAGCCTAATTTTTCATGG
Strand - +
Off-target summary {0: 10, 1: 67, 2: 63, 3: 124, 4: 487} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!