ID: 935735294_935735298

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 935735294 935735298
Species Human (GRCh38) Human (GRCh38)
Location 2:106101956-106101978 2:106101970-106101992
Sequence CCCTTCTCCTTCTCCTCCTCCAT CTCCTCCATCGTTACCAGTGAGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 128, 3: 790, 4: 3989} {0: 1, 1: 0, 2: 1, 3: 5, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!