ID: 935822472_935822480

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 935822472 935822480
Species Human (GRCh38) Human (GRCh38)
Location 2:106908083-106908105 2:106908122-106908144
Sequence CCTCTGAAGACCCTATTAGGGAG TTTCAGCTTCTGGTGGCTCCAGG
Strand - +
Off-target summary No data {0: 10, 1: 97, 2: 312, 3: 518, 4: 1127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!