ID: 936289595_936289602

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 936289595 936289602
Species Human (GRCh38) Human (GRCh38)
Location 2:111211309-111211331 2:111211349-111211371
Sequence CCCTGCAACCTCTGCATCCCAGG TCTCAGCCTCCCAAGTAGCTGGG
Strand - +
Off-target summary No data {0: 6552, 1: 107713, 2: 216650, 3: 253203, 4: 265968}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!