ID: 936289599_936289601

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 936289599 936289601
Species Human (GRCh38) Human (GRCh38)
Location 2:111211326-111211348 2:111211348-111211370
Sequence CCCAGGTTCAAGTGATTGTTGTG GTCTCAGCCTCCCAAGTAGCTGG
Strand - +
Off-target summary {0: 10, 1: 908, 2: 5860, 3: 38579, 4: 109351} {0: 4912, 1: 94001, 2: 203927, 3: 240558, 4: 231711}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!