ID: 936332196_936332203

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 936332196 936332203
Species Human (GRCh38) Human (GRCh38)
Location 2:111557283-111557305 2:111557309-111557331
Sequence CCCCACCCCTATCTATTCTATAC TTGGAAGAAAATCACTATGTAGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 2, 3: 14, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!