ID: 936367924_936367931

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 936367924 936367931
Species Human (GRCh38) Human (GRCh38)
Location 2:111877464-111877486 2:111877515-111877537
Sequence CCATCAGCCAGTTTTAATAATTA GCCTGTAATCCCAGCACTTTGGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 10, 3: 81, 4: 506} {0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!