ID: 936367925_936367929

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 936367925 936367929
Species Human (GRCh38) Human (GRCh38)
Location 2:111877471-111877493 2:111877487-111877509
Sequence CCAGTTTTAATAATTATCAAGCT TCAAGCTTGGCTGGGCATGATGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 17, 4: 331} {0: 1, 1: 2, 2: 21, 3: 213, 4: 2225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!