|
Left Crispr |
Right Crispr |
Crispr ID |
936367925 |
936367931 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:111877471-111877493
|
2:111877515-111877537
|
Sequence |
CCAGTTTTAATAATTATCAAGCT |
GCCTGTAATCCCAGCACTTTGGG |
Strand |
- |
+ |
Off-target summary |
{0: 2, 1: 0, 2: 2, 3: 17, 4: 331} |
{0: 215700, 1: 270647, 2: 186590, 3: 142154, 4: 223611} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|