|
Left Crispr |
Right Crispr |
Crispr ID |
936425651 |
936425654 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:112415765-112415787
|
2:112415788-112415810
|
Sequence |
CCCACCTATTCAGGAGGCAGAGA |
CAAGAGAATCACTTGAACCCAGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 11, 2: 757, 3: 15795, 4: 133194} |
{0: 1769, 1: 42452, 2: 114404, 3: 164204, 4: 204515} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|