ID: 936425651_936425655

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 936425651 936425655
Species Human (GRCh38) Human (GRCh38)
Location 2:112415765-112415787 2:112415791-112415813
Sequence CCCACCTATTCAGGAGGCAGAGA GAGAATCACTTGAACCCAGGAGG
Strand - +
Off-target summary {0: 5, 1: 11, 2: 757, 3: 15795, 4: 133194} {0: 21628, 1: 64917, 2: 122797, 3: 157734, 4: 166761}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!