|
Left Crispr |
Right Crispr |
| Crispr ID |
936425653 |
936425656 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
2:112415769-112415791
|
2:112415797-112415819
|
| Sequence |
CCTATTCAGGAGGCAGAGACAAG |
CACTTGAACCCAGGAGGCAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 1, 2: 18, 3: 235, 4: 1701} |
{0: 9186, 1: 33764, 2: 74834, 3: 112568, 4: 133392} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|