ID: 936425653_936425656

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 936425653 936425656
Species Human (GRCh38) Human (GRCh38)
Location 2:112415769-112415791 2:112415797-112415819
Sequence CCTATTCAGGAGGCAGAGACAAG CACTTGAACCCAGGAGGCAGAGG
Strand - +
Off-target summary {0: 7, 1: 1, 2: 18, 3: 235, 4: 1701} {0: 9186, 1: 33764, 2: 74834, 3: 112568, 4: 133392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!