ID: 937003611_937003618

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 937003611 937003618
Species Human (GRCh38) Human (GRCh38)
Location 2:118490846-118490868 2:118490876-118490898
Sequence CCGCAACAGGCAGTATGGCACCC ACCAAAATGGAAAAAGGTTATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 26, 4: 340}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!