ID: 937031688_937031697

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 937031688 937031697
Species Human (GRCh38) Human (GRCh38)
Location 2:118746048-118746070 2:118746091-118746113
Sequence CCTCCCACTGTGTCCCTCTCATG CTACAATTCAAGATGAGATTTGG
Strand - +
Off-target summary No data {0: 4048, 1: 7216, 2: 8939, 3: 8984, 4: 9244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!