|
Left Crispr |
Right Crispr |
Crispr ID |
937031688 |
937031698 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
2:118746048-118746070
|
2:118746092-118746114
|
Sequence |
CCTCCCACTGTGTCCCTCTCATG |
TACAATTCAAGATGAGATTTGGG |
Strand |
- |
+ |
Off-target summary |
No data |
{0: 6802, 1: 10434, 2: 9513, 3: 7783, 4: 4679} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|