ID: 937031688_937031699

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 937031688 937031699
Species Human (GRCh38) Human (GRCh38)
Location 2:118746048-118746070 2:118746095-118746117
Sequence CCTCCCACTGTGTCCCTCTCATG AATTCAAGATGAGATTTGGGTGG
Strand - +
Off-target summary No data {0: 7468, 1: 11239, 2: 9760, 3: 8452, 4: 6791}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!