ID: 937046091_937046100

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 937046091 937046100
Species Human (GRCh38) Human (GRCh38)
Location 2:118852794-118852816 2:118852837-118852859
Sequence CCGCGCCGGGCGCAGAGGGCGCC GTCGCCGCTCGCGGGTTTGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 3, 4: 14}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!