ID: 937065075_937065091

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 937065075 937065091
Species Human (GRCh38) Human (GRCh38)
Location 2:119011633-119011655 2:119011685-119011707
Sequence CCCTCCAGGAGCCGGCCGGTGTC GAGGCTGCGGCTCCCCGCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 107} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!