ID: 937099761_937099765

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 937099761 937099765
Species Human (GRCh38) Human (GRCh38)
Location 2:119259740-119259762 2:119259759-119259781
Sequence CCTCACTGGGGCTACTAAGGCTG GCTGGCTTTCCAGGCCTGGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!