ID: 937113711_937113715

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 937113711 937113715
Species Human (GRCh38) Human (GRCh38)
Location 2:119387953-119387975 2:119387989-119388011
Sequence CCATGAGTCATCTAGAAATGGTG GCAGATGACACCATTTCCAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 137} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!