ID: 937369005_937369020

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 937369005 937369020
Species Human (GRCh38) Human (GRCh38)
Location 2:121284997-121285019 2:121285031-121285053
Sequence CCGGCCCGCCGGCCCGGCCCGAG CCGCGCGCGGCCCTTACCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 65, 4: 503} {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!