ID: 937397900_937397904

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 937397900 937397904
Species Human (GRCh38) Human (GRCh38)
Location 2:121554659-121554681 2:121554709-121554731
Sequence CCATTTATAGGAAATGTCCAGAA GACACACCATTGCCTAGAGCTGG
Strand - +
Off-target summary {0: 19, 1: 459, 2: 1304, 3: 1878, 4: 2327} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!