ID: 937620202_937620207

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 937620202 937620207
Species Human (GRCh38) Human (GRCh38)
Location 2:123976627-123976649 2:123976648-123976670
Sequence CCTAAAATTCCCATCCGTGAATT TTTTTGTCCTGGAGAAACAAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!