ID: 937620612_937620619

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 937620612 937620619
Species Human (GRCh38) Human (GRCh38)
Location 2:123980687-123980709 2:123980722-123980744
Sequence CCAGGGTTGGGGGGTGGGGGTAC CACAGGGATGGAGCTTCCCAAGG
Strand - +
Off-target summary No data {0: 4, 1: 67, 2: 334, 3: 620, 4: 1152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!