ID: 937659692_937659696

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 937659692 937659696
Species Human (GRCh38) Human (GRCh38)
Location 2:124416647-124416669 2:124416676-124416698
Sequence CCTTCCCTTTTTCTCTTTCTAGG TTTTTAAAAAATCTGTAAAATGG
Strand - +
Off-target summary No data {0: 3, 1: 4, 2: 41, 3: 304, 4: 2036}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!