ID: 937665586_937665589

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 937665586 937665589
Species Human (GRCh38) Human (GRCh38)
Location 2:124483340-124483362 2:124483367-124483389
Sequence CCAGTGGCTACATATCAAGTAAT AAGGCTGAAATTGTTAAAAATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!