ID: 937695904_937695905

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 937695904 937695905
Species Human (GRCh38) Human (GRCh38)
Location 2:124808326-124808348 2:124808344-124808366
Sequence CCAGGCACGGTGGCTCATGCTTG GCTTGTAATCTCAGTACTTCAGG
Strand - +
Off-target summary {0: 237, 1: 8658, 2: 46271, 3: 118247, 4: 161180} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!