ID: 937878812_937878822

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 937878812 937878822
Species Human (GRCh38) Human (GRCh38)
Location 2:126849893-126849915 2:126849934-126849956
Sequence CCTCCCTGGTGCCTTTCATACAG AGGAGGAGGAGGAGCAGGAAGGG
Strand - +
Off-target summary No data {0: 2, 1: 67, 2: 529, 3: 1845, 4: 5875}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!