ID: 937950997_937951006

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 937950997 937951006
Species Human (GRCh38) Human (GRCh38)
Location 2:127387905-127387927 2:127387944-127387966
Sequence CCGCGGCACCCTCGTCAGGCGCC AGCCCGGCAGCCACTACACACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 90} {0: 1, 1: 0, 2: 2, 3: 11, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!