ID: 938000852_938000856

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 938000852 938000856
Species Human (GRCh38) Human (GRCh38)
Location 2:127735349-127735371 2:127735390-127735412
Sequence CCATAGGATCCCAAAGCTCGGTG ACATAATAAGTTTTATTTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 41, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!