ID: 938128997_938128998

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 938128997 938128998
Species Human (GRCh38) Human (GRCh38)
Location 2:128694615-128694637 2:128694628-128694650
Sequence CCTGGGGTGATGCTGCCCCGCAG TGCCCCGCAGCGTTGCCGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 50, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!