ID: 938292573_938292578

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 938292573 938292578
Species Human (GRCh38) Human (GRCh38)
Location 2:130157873-130157895 2:130157888-130157910
Sequence CCTCAGACCTGTAATTCCAGCAC TCCAGCACTTTGGGAGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 60, 2: 1049, 3: 3192, 4: 3185} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!