ID: 938484429_938484436

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 938484429 938484436
Species Human (GRCh38) Human (GRCh38)
Location 2:131689634-131689656 2:131689657-131689679
Sequence CCAACCATGTGCGGACGGACATG GGGTGGGTCATTTCAAAGTGAGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 1, 3: 27, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!